|
|
|
| Our products |
|
|
 |
|
|
|
|
|
|
|
|
| Other information |
|
|
|
DICER1 - Human, 4 unique 29mer shRNA constructs in retroviral GFP vector - TG304991 |
| Imprimer |
 DICER1 (Gene ID 23405) Human shRNA  Also for DICER1 (Locus ID 23405) | This kit containing following constructs: (Negative scrambled control is provided with each shipment) | | Sequences | Tube ID | Species Specificity (human, mouse, rat) | | AATGGTTACTTATCACTGTCAGACATTAA | TG304991A | H,M | | CCAAGAGTTTACTAAGCACCAGGTTCTCA | TG304991B | H,M | | GGCAAACAAGATCCAGAGCTGGCTTATAT | TG304991C | H,M | | ACCAATCTCAACCAGCCACTGCTGGATGT | TG304991D | H,M | | Reference Data | RefSeq: NM_001195573 NM_001271282 NM_030621 NM_177438 | | Synonyms: DCR1; Dicer; HERNA; MNG1 | | Summary: This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep | | shRNA Design: These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, align it with our published shRNA design sequences. If these do not align, please utilize our custom shRNA service . Performance Guranteed: OriGene guarantees that the sequences in the shRNA expression cassettes are verified to correspond to the target gene with 100% identity. One of the four constructs at minimum are guaranteed to produce 70% or more gene expression knock-down provided a minimum transfection efficiency of 80% is achieved. Western Blot data is recommended over qPCR to evaluate the silencing effect of the shRNA constructs 72 hrs post transfection. To properly assess knockdown, the gene expression level from the included scramble control vector must be used in comparison with the target-specific shRNA transfected samples.
For non-conforming shRNA, requests for replacement product must be made within ninety (90) days from the date of delivery of the shRNA kit. To arrange for a free replacement with newly designed constructs, please contact Technical Services at tech@clinisciences.com. Please provide your data indicating the transfection efficiency and measurement of gene expression knockdown compared to the scrambled shRNA control (Western Blot data preferred). * Delivery time in business days.Occasional delay may occur due to complexity of the constructs. The use of this shRNA has been cited in the following citations: Aging-Induced Dysregulation of Dicer1-Dependent MicroRNA Expression Impairs Angiogenic Capacity of Rat Cerebromicrovascular Endothelial Cells, Zoltan Ungvari, Zsuzsanna Tucsek, Danuta Sosnowska, Peter Toth, Tripti Gautam, Andrej Podlutsky, Agnes Csiszar, Gyorgy Losonczy, M. Noa Valcarcel-Ares, William E. Sonntag, and Anna Csiszar, J Gerontol A Biol Sci Med Sci, Dec 2012; 10.1093/gerona/gls242. [DICER1] More shRNA Citations >> | Researchers who bought this RNAi have also purchased: | | | Related Transfection Reagent Western Blotting Reagents Competent Cells for Transformation | | Product Manuals MSDS FAQs * Delivery time is an estimate in business days. Occasional delays may occur due to unforeseen complexities in the preparation of your construct. International customers may expect an additional 1-2 weeks in shipping |  |
|