|
|
|
| Our products |
|
|
 |
|
|
|
|
|
|
|
|
| Other information |
|
|
|
Lancl2 - Mouse, 4 unique 29mer shRNA constructs in retroviral GFP vector - TG504622 |
| Imprimer |
 LANCL2 (Gene ID 71835) Mouse shRNA  Also for LANCL2 (Locus ID 71835) | This kit containing following constructs: (Negative scrambled control is provided with each shipment) | | Sequences | Tube ID | Species Specificity (human, mouse, rat) | | GTATGCCTTACTGTACCTGAACACAGAGA | TG504622A | H,M | | TTGCAGAGTGGTGTCTAGATTACGGAGCA | TG504622B | H,M | | CATGGAGTGTAGCGATGTGATTTGGCAGC | TG504622C | H,M | | GCATAGAACTATTGTCTGTCAAGAGTCAG | TG504622D | M | | Reference Data shRNA Design: These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, align it with our published shRNA design sequences. If these do not align, please utilize our custom shRNA service . Performance Guranteed: OriGene guarantees that the sequences in the shRNA expression cassettes are verified to correspond to the target gene with 100% identity. One of the four constructs at minimum are guaranteed to produce 70% or more gene expression knock-down provided a minimum transfection efficiency of 80% is achieved. Western Blot data is recommended over qPCR to evaluate the silencing effect of the shRNA constructs 72 hrs post transfection. To properly assess knockdown, the gene expression level from the included scramble control vector must be used in comparison with the target-specific shRNA transfected samples.
For non-conforming shRNA, requests for replacement product must be made within ninety (90) days from the date of delivery of the shRNA kit. To arrange for a free replacement with newly designed constructs, please contact Technical Services at tech@clinisciences.com. Please provide your data indicating the transfection efficiency and measurement of gene expression knockdown compared to the scrambled shRNA control (Western Blot data preferred). * Delivery time in business days.Occasional delay may occur due to complexity of the constructs. shRNA Citations: Deacetylation of p53 induces autophagy by suppressing Bmf expression, Amelia U. Contreras, Yohannes Mebratu, Monica Delgado, Gilbert Montano, Chien-an A. Hu, Stefan W. Ryter, Augustine M.K. Choi, Yuting Lin, Jialing Xiang, Hitendra Chand, and Yohannes Tesfaigzi, J. Cell Biol., Apr 2013; 201: 427 - 437. [p53] Premetastatic soil and prevention of breast cancer brain metastasis, Yan Liu, Akemi Kosaka, Maki Ikeura, Gary Kohanbash, Wendy Fellows-Mayle, Linda A. Snyder, and Hideho Okada, Neuro Oncology, Apr 2013; 10.1093/neuonc/not031. [COX2] Altered localization, abnormal modification and loss of function of Sigma receptor-1 in amyotrophic lateral sclerosis, J. Prause, A. Goswami, I. Katona, A. Roos, M. Schnizler, E. Bushuven, A. Dreier, S. Buchkremer, S. Johann, C. Beyer, M. Deschauer, D. Troost, and J. Weis, Hum. Mol. Genet., Apr 2013; 22: 1581 - 1600. [SIGMAR1] Histone Deacetylase 2 Cell Autonomously Suppresses Excitatory and Enhances Inhibitory Synaptic Function in CA1 Pyramidal Neurons, Jesse E. Hanson, Lunbin Deng, David H. Hackos, Shih-Ching Lo, Benjamin E. Lauffer, Pascal Steiner, and Qiang Zhou, J. Neurosci., Apr 2013; 33: 5924 - 5929. [HDAC1] Inositol Polyphosphate Multikinase Is a Coactivator of p53-Mediated Transcription and Cell Death, Risheng Xu, Nilkantha Sen, Bindu D. Paul, Adele M. Snowman, Feng Rao, M. Scott Vandiver, Jing Xu, and Solomon H. Snyder, Sci. Signal., Apr 2013; 6: ra22. [IPMK] Cooperative Activation of Tissue-Specific Genes by pRB and E2F1, Stephen Flowers, Fuhua Xu, and Elizabeth Moran, Cancer Res., Apr 2013; 73: 2150 - 2158. [E2F1] 15-PGDH inhibits hepatocellular carcinoma growth through 15-keto-PGE2/PPAR?-mediated activation of p21WAF1/Cip1, D Lu, C Han & T Wu, Oncogene doi:10.1038/onc.2013.69 [CDKN1A ] ACP5, a direct transcriptional target of FoxM1, promotes tumor metastasis and indicates poor prognosis in hepatocellular carcinoma, L Xia, W Huang, D Tian, Z Chen, L Zhang, + et al., Oncogene doi:10.1038/onc.2013.90 [ACP5 ] RNH1 regulation of reactive oxygen species contributes to histone deacetylase inhibitor resistance in gastric cancer cells, Y Zhu, K Das, J Wu, M H Lee & P Tan, Oncogene doi:10.1038/onc.2013.104 [RNH1 ] Identification and Cytoprotective Function of a Novel Nestin Isoform, Nes-S, in Dorsal Root Ganglia Neurons, Peng-Han Su, Chih-Cheng Chen, Ya-Fan Chang, Zong-Ruei Wong, Kai-Wei Chang, Bu-Miin Huang, and Hsi-Yuan Yang, J. Biol. Chem., Mar 2013; 288: 8391 - 8404. [NES] More shRNA Citations >> | Researchers who bought this RNAi have also purchased: | | | Related Transfection Reagent Western Blotting Reagents Competent Cells for Transformation | | Product Manuals MSDS FAQs * Delivery time is an estimate in business days. Occasional delays may occur due to unforeseen complexities in the preparation of your construct. International customers may expect an additional 1-2 weeks in shipping |  |
|