|
|
|
| Our products |
|
|
 |
|
|
|
|
|
|
|
|
| Other information |
|
|
|
DUSP8 - Human, 4 unique 29mer shRNA constructs in retroviral untagged vector - TR313344 |
| Imprimer |
 DUSP8 (Gene ID 1850) Human shRNA 
 Also for DUSP8 (Locus ID 1850)  | This kit containing following constructs: (Negative scrambled control is provided with each shipment) | | Sequences | Tube ID | Species Specificity
(human, mouse, rat) | | CCAAGCCTGACTTCATCTGCGAGAGCCGC | TR313344A | H | | GCTGCCAAGTCATCGTCCACTGTCTGGCT | TR313344B | H | | GGACACTAACCGCCTCAAGCGCTCCTTCT | TR313344C | H | | TGCTGGCCGCAGACAGCTTCCTCTCCATC | TR313344D | H | | Reference Data | RefSeq: NM_004420 | | Synonyms: C11orf81; HB5; HVH-5; HVH8 | | Summary: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates SAPK/JNK and p38, is expressed predominantly in the adult brain, heart, and skeletal muscle, is localized in the cytoplasm, and is induced by nerve growth factor and insulin. An intronless pseudogene for DUSP8 is present on chromosome 10q11.2. [provided by RefSeq, Jul 2008]. | |
shRNA Design: These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, align it with our published shRNA design sequences. If these do not align, please utilize our custom shRNA service . Performance Guranteed: OriGene guarantees that the sequences in the shRNA expression cassettes are verified to correspond to the target gene with 100% identity. One of the four constructs at minimum are guaranteed to produce 70% or more gene expression knock-down provided a minimum transfection efficiency of 80% is achieved. Western Blot data is recommended over qPCR to evaluate the silencing effect of the shRNA constructs 72 hrs post transfection. To properly assess knockdown, the gene expression level from the included scramble control vector must be used in comparison with the target-specific shRNA transfected samples.
For non-conforming shRNA, requests for replacement product must be made within ninety (90) days from the date of delivery of the shRNA kit. To arrange for a free replacement with newly designed constructs, please contact Technical Services at tech@clinisciences.com. Please provide your data indicating the transfection efficiency and measurement of gene expression knockdown compared to the scrambled shRNA control (Western Blot data preferred). * Delivery time in business days.Occasional delay may occur due to complexity of the constructs. shRNA Citations:
The SNARE Proteins SNAP25 and Synaptobrevin Are Involved in Endocytosis at Hippocampal Synapses, Zhen Zhang, Dongsheng Wang, Tao Sun, Jianhua Xu, Hsueh-Cheng Chiang, Wonchul Shin, and Ling-Gang Wu, J. Neurosci., May 2013; 33: 9169 - 9175. [SNAP25 ]
The SNARE Proteins SNAP25 and Synaptobrevin Are Involved in Endocytosis at Hippocampal Synapses, Zhen Zhang, Dongsheng Wang, Tao Sun, Jianhua Xu, Hsueh-Cheng Chiang, Wonchul Shin, and Ling-Gang Wu, J. Neurosci., May 2013; 33: 9169 - 9175. [VAMP2 ]
Mitochondrial transcription factor A regulated ionizing radiation-induced mitochondrial biogenesis in human lung adenocarcinoma A549 cells, Jing Yu, Qisen Wang, Ni Chen, Yuxiang Sun, Xiaofei Wang, Lijun Wu, Shaopeng Chen, Hang Yuan, An Xu, and Jun Wang, J Radiat Res, May 2013; 10.1093/jrr/rrt046. [TFAM]
Inhibition of prolyl 4-hydroxylase, beta polypeptide (P4HB) attenuates temozolomide resistance in malignant glioma via the endoplasmic reticulum stress response (ERSR) pathways, Stella Sun, Derek Lee, Amy S.W. Ho, Jenny K.S. Pu, X.Q. Zhang, Nikki P. Lee, Philip J.R. Day, W.M. Lui, C.F. Fung, and Gilberto K.K. Leung, Neuro Oncology, May 2013; 15: 562 - 577. [P4HB]
Steroidogenic enzyme Cyp11a1 regulates Type 2 CD8+ T cell skewing in allergic lung disease, Yi Jia, Joanne Domenico, Katsuyuki Takeda, Junyan Han, Meiqin Wang, Michael Armstrong, Nichole Reisdorph, Brian P. O'Connor, Joseph J. Lucas, and Erwin W. Gelfand, PNAS, May 2013; 110: 8152 - 8157. [Cyp11a1 ]
miR-26a Plays an Important Role in Cell Cycle Regulation in ACTH-Secreting Pituitary Adenomas by Modulating Protein Kinase C, Erica Gentilin, Federico Tagliati, Carlo Filieri, Daniela Molè, Mariella Minoia, Maria Rosaria Ambrosio, Ettore C degli Uberti, and Maria Chiara Zatelli, Endocrinology, May 2013; 154: 1690 - 1700. [PRKCD]
BAF complexes facilitate decatenation of DNA by topoisomerase IIa, Emily C. Dykhuizen, Diana C. Hargreaves, Erik L. Miller, Kairong Cui, Andrey Korshunov, + et al., Nature 497, 624-627 doi:10.1038/nature12146 [Arid1a ]
Deacetylation of p53 induces autophagy by suppressing Bmf expression, Amelia U. Contreras, Yohannes Mebratu, Monica Delgado, Gilbert Montano, Chien-an A. Hu, Stefan W. Ryter, Augustine M.K. Choi, Yuting Lin, Jialing Xiang, Hitendra Chand, and Yohannes Tesfaigzi, J. Cell Biol., Apr 2013; 201: 427 - 437. [p53]
Premetastatic soil and prevention of breast cancer brain metastasis, Yan Liu, Akemi Kosaka, Maki Ikeura, Gary Kohanbash, Wendy Fellows-Mayle, Linda A. Snyder, and Hideho Okada, Neuro Oncology, Apr 2013; 10.1093/neuonc/not031. [COX2]
Altered localization, abnormal modification and loss of function of Sigma receptor-1 in amyotrophic lateral sclerosis, J. Prause, A. Goswami, I. Katona, A. Roos, M. Schnizler, E. Bushuven, A. Dreier, S. Buchkremer, S. Johann, C. Beyer, M. Deschauer, D. Troost, and J. Weis, Hum. Mol. Genet., Apr 2013; 22: 1581 - 1600. [SIGMAR1] More shRNA Citations >> | Researchers who bought this RNAi have also purchased: |
|
| Related Transfection Reagent Western Blotting Reagents Competent Cells for Transformation |
| Product Manuals
MSDS
FAQs
* Delivery time is an estimate in business days. Occasional delays may occur due to unforeseen complexities in the preparation of your construct. International customers may expect an additional 1-2 weeks in shipping |
 |
|
