Specifications

Product Data
Locus ID	4609
Forward Sequence	CCTGGTGCTCCATGAGGAGAC
Reverse Sequence	CAGACTCTGACCTTTTGCCAGG
ACCN	NM_002467, NM_002467.1, NM_002467.2, NM_002467.3, NM_002467.4, BC000141, BC000141.1, BC000917, BC058901, BG499628, BK006467, BT019768, NM_002467.6
UniProt ID	P01106
Synonyms	bHLHe39; c-Myc; MRTL; MYCC
Components	1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control	The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage	Store at -20°C.
Stability	The primer mix is stable for one year from date of shipping.
Shipping	Ambient

Product Manuals

qSTAR Expression Detection System

FAQs

FAQ for qPCR Products

SDS for HP206146

Gene Expression Resources

4-min CRISPR Quick-Learning Video Video Protocol: Gene Knockout with CRISPR Kit Frequently Asked Questions on CRISPR Webinar from Cell: Expanding CRISPR Toolbox CRISPR Knockout kit manual CRISPR vector manual CRISPR Trangene Knockin at AAVS1 and ROSA26 loci manual CRISPR activation (CRISPRa) and CRISPR interference (CRISPRi) manual HA-Tagging Validation Data qPCR manual Mycoplasma Detection Kit w/ IAC Video Protocol: MycoTrackTM