Cystatin SA (CST2) (NM_001322) Human 3' UTR Clone

Référence SC203131

Conditionnement : 10ug


Cystatin SA (CST2) (NM_001322) Human 3' UTR Clone

Be the first to review this product
SKU
SC203131
3' UTR clone of cystatin SA (CST2) for miRNA target validation
 
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Cystatin SA
ACCN NM_001322
Insert Size 281 bp
Sequence Data
Insert Sequence
>SC203131 3’UTR clone of NM_001322
The sequence shown below is from the reference sequence of NM_001322. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGTGAATTCCAGGTGTCAAGAAGCCTAGGGATCTGTGCCAGGGAGTCACACTGACCACCTCCTACTC
CCACCCCTTGTAGTGCTCCCACCCCTGGACTGGTGGCCCCCACCCTGTGGGAGGTCTCCCCATGCACCT
GCAGCAGGAGAAGACAGAGAAGGCTGCAGGAGGCCTTTGTTGCTCAGCAGGGGACTCTGCCCTCCCTCC
TTCCTTTTGCTTCTCATAGCCCTGGTACATGGTACACACACCCCCACCTCCTGCAATTAAACAGTAGCA
TCACC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001322.3
Locus ID 1470
MW 9.9
Summary The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a secreted thiol protease inhibitor found at high levels in saliva, tears and seminal plasma. provided by RefSeq, Jul 2008

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products