Polink-1 HRP Goat DAB Detection Kit
Référence D33-110
Conditionnement : 110ml
Polink-1 HRP Goat DAB Detection Kit
SKU
D33-110
Polink-1 HRP Polymer Detection for GOAT antibody on human or animal tissue
Citations
The Unkempt RNA binding protein reveals a local translation program in centriole overduplication
Martinez, Stemm-Wolf, Sheridan et al
bioRxiv (2024)
Martinez, Stemm-Wolf, Sheridan et al
bioRxiv (2024)
Cited by 1
Snippet: (Horizon Discovery siGENOME M-022950-01-0010);CCTGAAAGAATTCCGCACA, AAGCACAAATACAGGTCGT, CCACCAAGTGCAACGACAT, GGAGAAGACTTTCGATAAC, targets. To generate WTsiR and Mut.siR Unk, Human Unk was first amplified from cDNA (Origene SC315847) using Fwd: 5’ ACAGTCGACATGTCGAAGGGCCCCGG 3’ and Rev: 5’
CD20 CAR T-cells safely and reversibly ablate B-cell follicles in a nonhuman primate model of HIV persistence
Bui, Starke, Poole et al
Mol Ther (2024)
Bui, Starke, Poole et al
Mol Ther (2024)
Cited by 15
AI Summary: OriGene’s Goat Polink-1 HRP (Cat. No. D33-110) was used as a detection reagent in immunohistochemistry to visualize tissue samples and assess the impact of CD20 CAR T-cells on B-cell follicles in this study.
Snippet: …Slides were 503 then incubated with Goat Polink-1 HRP (GBI Labs, Origene, Rockville, MD;Cat. No. D33-110). 504 Slides were developed using Impact DAB (3,3’-diaminobenzidine;Vector Laboratories, Newark, 505 CA), washed in ddH2O, counterstained with hematoxylin (Biocare Medical), mounted in 506 Permount (Fisher Scientific, Waltham, MA), and scanned at 20x ma
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.