MP217660 | Tph2 Mouse qPCR Primer Pair (NM

Tph2 Mouse qPCR Primer Pair (NM_173391)

Be the first to review this product

SKU

MP217660

qSTAR qPCR primer pairs against Mus musculus gene Tph2

Specifications
Product Data
Locus ID	216343
Forward Sequence	CCACCATTGTGACCCTGAATCC
Reverse Sequence	ATGAGGACTCGGTGAGAGCATC
ACCN	BC120514, BC125430, NM_173391, NM_173391.1, NM_173391.2, NM_173391.3
UniProt ID	Q8CGV2
Synonyms	AU043594; Ntph
Components	1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control	The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage	Store at -20°C.
Stability	The primer mix is stable for one year from date of shipping.
Shipping	Ambient

Product Manuals
qSTAR Expression Detection System
FAQs
FAQ for qPCR Products
SDS for MP217660

Gene Expression Resources
4-min CRISPR Quick-Learning Video Video Protocol: Gene Knockout with CRISPR Kit Frequently Asked Questions on CRISPR Webinar from Cell: Expanding CRISPR Toolbox CRISPR Knockout kit manual CRISPR vector manual CRISPR Trangene Knockin at AAVS1 and ROSA26 loci manual CRISPR activation (CRISPRa) and CRISPR interference (CRISPRi) manual HA-Tagging Validation Data qPCR manual Mycoplasma Detection Kit w/ IAC Video Protocol: MycoTrack^TM

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Tph2 Mouse qPCR Primer Pair (NM_173391)

Katalog-Nummer MP217660

Tph2 Mouse qPCR Primer Pair (NM_173391)

Citations

Related Products

Sie könnten auch an folgenden Produkten interessiert sein:

Tph2 Mouse qPCR Primer Pair (NM_173391)

Katalog-Nummer MP217660

Tph2 Mouse qPCR Primer Pair (NM_173391)

Other products for "Tph2 or BC120514"

file-alt Citations

Related Products

Sie könnten auch an folgenden Produkten interessiert sein:

Citations