Reagenzien und Instrumente für die Immunologie Zellbiologie und Molekularbiologie
 
> HSP90AB1 (NM_007355) Human 3' UTR Clone

HSP90AB1 (NM_007355) Human 3' UTR Clone

Drucken Drucken
Melden Sie sich an

Katalog-Nummer SC204035

Size : 10ug


HSP90AB1 (NM_007355) Human 3' UTR Clone

Be the first to review this product
SKU
SC204035
3' UTR clone of heat shock protein 90kDa alpha (cytosolic) class B member 1 (HSP90AB1) for miRNA target validation
 

Other products for "HSP90AB1 or NM_007355"

Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol HSP90AB1
Synonyms D6S182; HSP84; HSP90B; HSPC2; HSPCB
ACCN NM_007355
Insert Size 315 bp
Sequence Data
Insert Sequence
>SC204035 3’UTR clone of NM_007355
The sequence shown below is from the reference sequence of NM_007355. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATGCGTCTCGCATGGAAGAAGTCGATTAGGTTAGGAGTTCATAGTTGGAAAACTTGTGCCCTTGTATA
GTGTCCCCATGGGCTCCCACTGCAGCCTCGAGTGCCCCTGTCCCACCTGGCTCCCCCTGCTGGTGTCTA
GTGTTTTTTTCCCTCTCCTGTCCTTGTGTTGAAGGCAGTAAACTAAGGGTGTCAAGCCCCATTCCCTCT
CTACTCTTGACAGCAGGATTGGATGTTGTGTATTGTGGTTTATTTTATTTTCTTCATTTTGTTCTGAAA
TTAAAGTATGCAAAATAAAGAATATGCCGTTTTTATACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_007355.4
Locus ID 3326
MW 11.6
Summary This gene encodes a member of the heat shock protein 90 family; these proteins are involved in signal transduction, protein folding and degradation and morphological evolution. This gene encodes the constitutive form of the cytosolic 90 kDa heat-shock protein and is thought to play a role in gastric apoptosis and inflammation. Alternative splicing results in multiple transcript variants. Pseudogenes have been identified on multiple chromosomes. provided by RefSeq, Dec 2012
Product Manuals
FAQs
  • 3' UTR Clones
SDS

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products

Sie könnten auch an folgenden Produkten interessiert sein:



Katalog-Nummer
Beschreibung
Cond.
Preis zzgl. MwSt.