Human Glutathione Peroxidase 4 (GPX4) activation kit by CRISPRa

Referentie GA101938

Formaat : 1kit


Human Glutathione Peroxidase 4 (GPX4) activation kit by CRISPRa

Be the first to review this product
SKU
GA101938
GPX4 CRISPRa kit - CRISPR gene activation of human glutathione peroxidase 4
 
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol GPX4
Locus ID 2879
Components

GA101938G1, Glutathione Peroxidase 4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACTACTTAAGACTCGTCGA

GA101938G2, Glutathione Peroxidase 4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGTCTTAAGTAGTATTCTC

GA101938G3, Glutathione Peroxidase 4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGACCAATGAGCGCTCTGGA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001039847, NM_001039848, NM_002085, NM_001367832
UniProt ID P36969
Synonyms GPx-4; GSHPx-4; MCSP; PHGPx; snGPx; snPHGPx
Summary The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Mutations in this gene are associated with Sedaghatian type of spondylometaphyseal dysplasia (SMDS). This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. provided by RefSeq, Dec 2018
SKU Description Size
KN408065 GPX4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products