Tau (MAPT) Human qPCR Primer Pair (NM_016835)

Referentie HP228296

Formaat : 200reactions


Tau (MAPT) Human qPCR Primer Pair (NM_016835)

Be the first to review this product
SKU
HP228296
qSTAR qPCR primer pairs against Homo sapiens gene MAPT
 
Specifications
Product Data
Locus ID 4137
Forward Sequence CCAGTCCAAGTGTGGCTCAAAG
Reverse Sequence GCCTAATGAGCCACACTTGGAG
ACCN NM_016835, NM_016835.1, NM_016835.2, NM_016835.3, NM_016835.4, BC114948, BC000558, BC032572, BC040444, BC061892, BC071830, BC094805, BC098281, BC099721, BC101936, BC114504, BI552187, BN000503, BT006772
UniProt ID P10636
Synonyms DDPAC; FTDP-17; MAPTL; MSTD; MTBT1; MTBT2; PPND; PPP1R103; TAU; tau-40
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products

Misschien heeft u ook interesse in de volgende producten:



Referentie
Beschrijving
Cond.
Price Bef. VAT