Selenium Binding Protein 1 (SELENBP1) (NM_003944) Human 3' UTR Clone

Référence SC203172

Conditionnement : 10ug


Selenium Binding Protein 1 (SELENBP1) (NM_003944) Human 3' UTR Clone

Be the first to review this product
SKU
SC203172
3' UTR clone of selenium binding protein 1 (SELENBP1) for miRNA target validation
 
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Selenium Binding Protein 1
Synonyms EHMTO; HEL-S-134P; hSBP; LPSB; MTO; SBP56; SP56
ACCN NM_003944
Insert Size 269 bp
Sequence Data
Insert Sequence
>SC203172 3’UTR clone of NM_003944
The sequence shown below is from the reference sequence of NM_003944. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCGATTGTAGCTCTGACATCTGGATTTGAACTCCACCCTCATCACCCACACTCCCTATTTTGGGCCCT
CACTTCCTTGGGGACCTGGCTTCATTCTGCTCTCTCTTGGCACCCGACCCTTGGCAGCATGTACCACAC
AGCCAAGCTGAGACTGTGGCAATGTGTTGAGTCATATACATTTACTGACCACTGTTGCTTGTTGCTCAC
TGTGCTGCTTTTCCATGAGCTCTTGGAGGCACCAAGAAATAAACTCGTAACCCTGTCCTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003944.4
Locus ID 8991
MW 9.6
Summary This gene encodes a member of the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. The effects of selenium in preventing cancer and neurologic diseases may be mediated by selenium-binding proteins, and decreased expression of this gene may be associated with several types of cancer. The encoded protein may play a selenium-dependent role in ubiquitination/deubiquitination-mediated protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. provided by RefSeq, Apr 2012

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.