Reagentes e instrumentos para imunologia, biologia celular e biologia molecular.
 
> Monoamine Oxidase A (MAOA) Human qPCR Primer Pair (NM_000240)

Monoamine Oxidase A (MAOA) Human qPCR Primer Pair (NM_000240)

Imprimir Imprimir
Please log in

Referência HP200223

Tamanho : 200reactions


Monoamine Oxidase A (MAOA) Human qPCR Primer Pair (NM_000240)

Be the first to review this product
SKU
HP200223
qSTAR qPCR primer pairs against Homo sapiens gene MAOA
 

Other products for "MAOA or NM_000240"

Specifications
Product Data
Locus ID 4128
Forward Sequence TCTGAGCCTCACGAAGTGTCTG
Reverse Sequence ATCCGTTCGCTCACTTGACCAG
ACCN NM_000240, NM_000240.1, NM_000240.2, NM_000240.3, BC044787, BC044787.1, BC008064, BG534382, BT006651, BU684121, BX501303, NM_000240.4
UniProt ID P21397
Synonyms BRNRS; MAO-A
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Product Manuals
FAQs
  • FAQ for qPCR Products

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products

Você também pode estar interessado nos seguintes produtos:



Referência
Descrição
Cond.
Price Bef. VAT