Reagentes e instrumentos para imunologia, biologia celular e biologia molecular.
 
> Prealbumin (TTR) Human qPCR Primer Pair (NM_000371)

Prealbumin (TTR) Human qPCR Primer Pair (NM_000371)

Imprimir Imprimir
Please log in

Referência HP200351

Tamanho : 200reactions


Prealbumin (TTR) Human qPCR Primer Pair (NM_000371)

Be the first to review this product
SKU
HP200351
qSTAR qPCR primer pairs against Homo sapiens gene TTR
 

Other products for "TTR or NM_000371"

Specifications
Product Data
Locus ID 7276
Forward Sequence CGTGCATGTGTTCAGAAAGGCTG
Reverse Sequence CTCCTCAGTTGTGAGCCCATGC
ACCN NM_000371, NM_000371.1, NM_000371.2, NM_000371.3, BC020791, BC020791.1, BC005310, BT007189, NM_000371.4
UniProt ID P02766
Synonyms ATTR; CTS; CTS1; HEL111; HsT2651; PALB; TBPA; TTN
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Product Manuals
FAQs
  • FAQ for qPCR Products

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products

Você também pode estar interessado nos seguintes produtos:



Referência
Descrição
Cond.
Price Bef. VAT