Size : 200reactions
| Product Data | |
| Locus ID | 3569 |
|---|---|
| Forward Sequence | AGACAGCCACTCACCTCTTCAG |
| Reverse Sequence | TTCTGCCAGTGCCTCTTTGCTG |
| ACCN | BC015511, NM_000600, NM_000600.1, NM_000600.2, NM_000600.3, NM_000600.4, BT019748, BT019749, NM_000600.5 |
| UniProt ID | P05231 |
| Synonyms | BSF-2; BSF2; CDF; HGF; HSF; IFN-beta-2; IFNB2; IL-6 |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
| Product Manuals |
| FAQs |
|