mmu-miR-6927-3p miRNA Mimic

Cat# CMM1322-5nmol

Size : 5nmol

Brand : Cohesion Biosciences

Request more information

Contact local distributor :


Phone : +1 850 650 7790

Product Name:mmu-miR-6927-3p miRNA Mimic
Cat No:CMM1322
Source:Synthetic
Reactivity:M
Applications:
*Application Key:
H - Human, M - Mouse, R - Rat, B - Bovine, C - Chicken, D - Dog, G - Goat, Mk - Monkey, P - Pig, Rb - Rabbit, S - Sheep, Z - Zebrafish
*Species Reactivity Key:
E- ELISA, WB - Western blot, IH - Immunohistochemistry, IF - Immunofluorescence, FC - Flow cytometry, IC - Immunocytochemistry, IP - Immunoprecipitation, ChIP - Chromatin Immunoprecipitation, EMSA - Electrophoretic Mobility Shift Assay, BL - Blocking, SE - Sandwich ELISA, CBE - Cell-based ELISA, RNAi - RNA interference
Description:Synthetic miRNA mimics are used to overexpress mmu-miR-6927-3p by transfaction.
Form:Lyophilized powder
Gene Symbol:mmu-miR-6927-3p
Entrez Gene (Mouse): MIMAT0027755;
Chemical Structure:CCUGAGCUGGCUCCCCUGCAG
Directions for Use:We recommend re-suspending the lyophilized synthetic miRNA using DNase and RNase-free ddH2O. To make a 100 uM stock, dissolve the lyophilized powder using 50 ul of ddH2O.
Components:This synthetic miRNA is based on the mature miRNA sequence. It does not contain the full precursor miRNA stem-loop.
Storage/Stability:Shipped at 4 °C. Store at -20 °C for one year. Avoid freeze-thaw cycles after reconstitution.