Size : 200reactions
| Product Data | |
| Locus ID | 6137 |
|---|---|
| Forward Sequence | CGCTCCAAACTCATCCTCTTCC |
| Reverse Sequence | CTCTTCCTCAGTGATGACTCGAG |
| ACCN | NM_000977, NM_000977.1, NM_000977.2, NM_000977.3, BC010994, BC010994.2, BC066320, BC066320.1, BC093063, BC093063.1, BC000851, BC004954, BC006179, BC007345, BC007563, BC007805, BC013078, BC014167, BC020804, BC027463, BC063378, BC106058, BG706207, NM_000977.4 |
| UniProt ID | P26373 |
| Synonyms | BBC1; D16S44E; D16S444E; L13; SEMDIST |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
| Product Manuals |
| FAQs |
|