Size : 1kit
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
|---|---|
| Target Symbol | GPX4 |
| Locus ID | 2879 |
| Components | GA101938G1, Glutathione Peroxidase 4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACTACTTAAGACTCGTCGA GA101938G2, Glutathione Peroxidase 4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGTCTTAAGTAGTATTCTC GA101938G3, Glutathione Peroxidase 4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGACCAATGAGCGCTCTGGA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_001039847, NM_001039848, NM_002085, NM_001367832 |
| UniProt ID | P36969 |
| Synonyms | GPx-4; GSHPx-4; MCSP; PHGPx; snGPx; snPHGPx |
| Summary | The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Mutations in this gene are associated with Sedaghatian type of spondylometaphyseal dysplasia (SMDS). This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. provided by RefSeq, Dec 2018 |
| Product Manuals |
| FAQs |
|
| SDS |
| SKU | Description | Size | ||
|---|---|---|---|---|
| KN408065 | GPX4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit | | |