Spaca6 (NM_001162909) Mouse Untagged Clone

Referencia MC211601

embalaje : 10ug


Spaca6 (NM_001162909) Mouse Untagged Clone

Be the first to review this product
SKU
MC211601
Ncrna00085 (untagged) - Mouse non-protein coding RNA 85 (Ncrna00085), (10ug)
 
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Spaca6
Synonyms 4930546H06Rik; 9530079D04Rik; B230206P06Rik; let-7e; mir-99b; mir-125a; Ncrna00085
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC211601 representing NM_001162909
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCTCACAAAGGTCACTATCTTCTCCTCAGACCCGGAGACCCTCTGTTATGGGTCTTATTTCCTTAG
TAGGGAGCATTGTCCTGTTGTTCCTGCTGATCTTCAGGGCATCCACGTGGGCCTGTCTCTTCTGCTTCAC
TACCTATGAGGAACGCCTCCGTGTCTGCCAGCTGTTTGTGGGCAGAGAGGAAACCAAGATAAACCTGTGC
AGAAATGAGCTTGAAGGGGCTTTTGAAGATCTCAAAGACATGAAAATCAACTATGATGAGAGGAGCTACC
TGCATGATGAATTTACACAGATGACAGTTTCTCTTCAGGAGAAGGCTGCTAGACGACGGGAGCCCTTTTG
GCTTGCCTTCAAAGATGCTGCTGCAAAATTGAAGAGGACCATTGAACACCTTAAAAAAGCCCCGGCCTGC
ATCCCTCCTTGTGGTCTCCAGGAGGTGGCTAGGCTTTTCCACTGCTCGGGCTGCTTTTCTAAACTCTGCG
ATCTGCCTCTCGATTGTCCAGTTCAGGACATGCTGGTGAACCGAGGGGACCAGGCTTTGTTTTCTTGTAT
CGTGGCTTTCGAGTTGCCAGAGTCGGAGATCACTTATTCCTGGAAATTTGTGGGAGGTGTCCGAACTAAG
GACGTTACGTACTTCCGTGATATGCCGGGGGCTCACGGGTACCTGGCACGAATACGGCCAGTGCAACCCA
AACACGGTGGGACCTTTTCCTGCGTGATCCTGCACGACCAGCGCCCCCTGGCGCGGCTCTACTTTTATCT
GAACGTGACGGGCCCTCCTCCGCCTGAGGACACTGAGCTCCAGGTCACGTTCCGGGAAGTGATGAATCGG
ACGCCGGCGGAGCCGGAAATGATCCAGCCCTGGAGCCCCAGCCTAGGCGAACTACTTACCAACCCCCAGG
CTCTGACGCTTGGCAACCTATTCCTGCTCGCGGCCACCGCTGCACTTGGGTCTGCCAGTGTTACTCTGCT
AGTGTGGCTGTTTTTTCGATGGTACTTAAGTGGCAACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001162909
Insert Size 1020 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at info@clinisciences.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001162909.1, NP_001156381.1
RefSeq Size 1102 bp
RefSeq ORF 1020 bp
Locus ID 75202
UniProt ID E9Q8Q8
Cytogenetics 17 A3.2
Summary Sperm protein potentially involved sperm-egg fusion.UniProtKB/Swiss-Prot Function
SKU Description Size
MG224526 Ncrna00085 (tGFP-tagged) - Mouse non-protein coding RNA 85 (Ncrna00085), (10ug) 10 ug
MR224526 Ncrna00085 (Myc-DDK-tagged) - Mouse non-protein coding RNA 85 (Ncrna00085) 10 ug
MR224526L3 Lenti ORF clone of Ncrna00085 (Myc-DDK-tagged) - Mouse non-protein coding RNA 85 (Ncrna00085) 10 ug
MR224526L4 Lenti ORF clone of Ncrna00085 (mGFP-tagged) - Mouse non-protein coding RNA 85 (Ncrna00085) 10 ug

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products